References

Zhu LJ, Lawrence M, Gupta A, Pages H, Kucukural A, Garber M and Wolfe SA (2017). “GUIDEseq: a bioconductor package to analyze GUIDE-Seq datasets for CRISPR-Cas nucleases.” BMC Genomics, 18(1). http://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-3746-y.

Main text of the article: Use cases

Additional File 1: Preprocessing steps to genereate alignment and umi files as input for GUIDEseq

Additional File 2: Installation and use of GUIDEseq (intended for new users of R and Bioconductor)

First load the GUIDEseq and annotation packages.

We are going to use a dataset generated from human samples, which has been included in the GUIDEseq package. To annotate the targets and off-targets, we need to load Human BSgenome package, Human Transcript and gene identifier mapping packages.

Note: It is critical to use the same version of the genome for sequence mapping (preprocessing) and for sequence analysis in GUIDEseq.

library(CRISPRseekGUIDEseqBioc2017Workshop)
library(GUIDEseq)
## 
## 
## Attaching package: 'GUIDEseq'
## The following object is masked from 'package:CRISPRseek':
## 
##     annotateOffTargets
library(BSgenome.Hsapiens.UCSC.hg19)
library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(org.Hs.eg.db)

Here are the commands to learn more about the GUIDEseq package and how to use the two workflow functions to perform GUIDE-seq data analysis for different types of CRISPR system and to compare different experiments.

help(GUIDEseqAnalysis)
help(combineOfftargets)
browseVignettes("GUIDEseq")

Example 1. Analysis of SpCas9 GUIDE-seq data

Although the analysis workflow function GUIDEseqAnalysis has more than 60 parameters for customized analysis, the majority of these parameters are pre-set for analyzing GUIDE-seq data from the most commonly used nuclease, SpCas9. Consequently when analyzing SpCas9 data only a small number of target-specific inputs are required from users.

There are four required inputs.
1) gRNA.file for specifying a file containing one or more gRNAs in fasta format;
2) alignment.file for specifying 1-2 files containing the sequence alignment in bam format;
3) umi.file for specifying 1-2 files containing UMI for each read;
4) BSgenomeName for specifying the BSgenome object containing the genome sequences
Please note that if outputDir is not specified, results will be automatically saved in a folder named according to the peak calling/merging/filtering criteria specified, e.g., gRNAmin80window20step20distance40 will be the default outputDir with the following code snippet.

The gRNA file can be created using a text editor or vi. Both alignment and umi files are generated in the preprocessing steps. The analysis results are saved as offTargetAnaysisOfPeaks.xls in the specified output directory.

    umi.inputfile <- c(system.file("extdata", "plusLibraryUMI.txt",
            package = "CRISPRseekGUIDEseqBioc2017Workshop"),
            system.file("extdata", "minusLibraryUMI.txt",
            package = "CRISPRseekGUIDEseqBioc2017Workshop"))
    alignment.inputfile <- c(system.file("extdata","plusLibrary.sort.bam" ,
            package = "CRISPRseekGUIDEseqBioc2017Workshop"),
            system.file("extdata","minusLibrary.sort.bam" ,
            package = "CRISPRseekGUIDEseqBioc2017Workshop"))
    gRNA.file <- system.file("extdata","gRNA.fa", package = "GUIDEseq")
    guideSeqRes <- GUIDEseqAnalysis(
            alignment.inputfile = alignment.inputfile,
            umi.inputfile = umi.inputfile, 
            gRNA.file = gRNA.file,
            orderOfftargetsBy = "peak_score",
            descending = TRUE, 
            BSgenomeName = Hsapiens, min.reads = 80, n.cores.max = 4)
## Remove duplicate reads ...
## Peak calling ...
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## combine plus and minus peaks ...
## keep peaks not in merged.gr but present in both peaks1 and peaks2
## Find unmerged peaks with reads representation in both libraries
## offtarget analysis ...
## search for gRNAs for input file1...
## [1] "Scoring ..."
## >>> Finding all hits in sequence chr13+:27629413:27629420:chr13-:27629400:27629404 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:39262927:39262939:chr13-:39262918:39262920 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:88900985:88901002:chr13-:88900981:88901000 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:30964712:30964730 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66687218:66687225 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:67161908:67161923 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79233416:79233436 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96233915:96233932 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98226906:98226924 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109316130:109316144 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29087136:29087137 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41110384:41110391 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:97395652:97395666 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:115084360:115084375 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## finish off-target search in sequence 2
## finish off-target search in sequence 1
## finish feature vector building
## finish score calculation
## [1] "Done!"
## Warning in if (!is.na(TS2)) {: the condition has length > 1 and only the
## first element will be used
## Done with offtarget search!
## Add gene and exon information to offTargets ....
## Extract PAM sequence and n.PAM.mismatch.
## Please check output file in directory gRNAmin80window20step20distance40
    guideSeqRes$offTargets
##                   offTarget peak_score predicted_cleavage_score
## 1 chr13:+:39262912:39262934       1894                      1.2
## 2 chr13:-:27629404:27629426       1380                      3.2
## 3 chr13:-:88900986:88901008        198                      1.6
##      gRNA.name             gRNAPlusPAM      offTarget_sequence
## 1 HEK239_site4 GGCACTGCGGCTGGAGGTGGNGG AGCAGTGCGGCTAGAGGTGGTGG
## 2 HEK239_site4 GGCACTGCGGCTGGAGGTGGNGG GGCACTGGGGTTGGAGGTGGGGG
## 3 HEK239_site4 GGCACTGCGGCTGGAGGTGGNGG CACACTGCAGCTGGAGGTGGTGG
##   guideAlignment2OffTarget offTargetStrand mismatch.distance2PAM
## 1     A...G.......A.......               +               20,16,8
## 2     .......G..T.........               -                 13,10
## 3     CA......A...........               -              20,19,12
##   n.PAM.mismatch n.guide.mismatch PAM.sequence offTarget_Start
## 1              0                3          TGG        39262912
## 2              0                2          GGG        27629404
## 3              0                3          TGG        88900986
##   offTarget_End chromosome
## 1      39262934      chr13
## 2      27629426      chr13
## 3      88901008      chr13

Please note that the alignment file, umi file and gRNA file are included in the GUIDEseq package. To run the analysis for your own data, please specify the file paths for target sequence (gRNA.file), sequence alignment (alignment.inputfile) and UMI input files (umi.inputfile). The following code assumes that the input files are located in the ~/GUIDEseqSpCas9Input directory.
The analysis results offTargetsInPeakRegions.xls will be saved in the ~/guideSeqResults directory as specified by outputDir.

library(GUIDEseq)
gRNA.file <- "~/GUIDEseqSpCas9Input/SpCas9gRNAexample.fa"
alignment.inputfile <- c("~/GUIDEseqSpCas9Input/plusLibrary.sort.bam",     
      "~/GUIDEseqSpCas9Input/minusLibrary.sort.bam")
umi.inputfile <- c("~/GUIDEseqSpCas9Input/plusLibraryUMI.txt", 
      "~/GUIDEseqSpCas9Input/minusLibraryUMI.txt")
outputDir <- "~/guideSeqResults"
guideSeqResults <- GUIDEseqAnalysis(
     alignment.inputfile = alignment.inputfile,
     umi.inputfile = umi.inputfile,
     gRNA.file = gRNA.file,
     BSgenomeName = Hsapiens, 
     outputDir = outputDir)

By default, the predicted cleavage score is calculated using the weight matrix and scoring algorithm from the Zhang laboratory. To use the algorithm developed by the Root Laboratory, set the scoring.method = “CFDscore”.

Example 2: Annotate off-targets

With parameters txdb and orgAnn set to an organism-specific transcript object and gene ID mapping object respectively, off-target sites are annotated to indicate whether the offtargets overlap with gene bodies and whether they fall within an exon. Here is an example for SpCas9 GUIDE-seq data processing that annotates identified potential off-target sites with features from the human genome.

library(TxDb.Hsapiens.UCSC.hg19.knownGene)
library(org.Hs.eg.db)
outputDir <- "~/guideSeqResults"
guideSeqResults <- GUIDEseqAnalysis(
    alignment.inputfile = alignment.inputfile,
    umi.inputfile = umi.inputfile,
    gRNA.file = gRNA.file,
    BSgenomeName = Hsapiens, 
    txdb = TxDb.Hsapiens.UCSC.hg19.knownGene, 
    orgAnn = org.Hs.egSYMBOL,
    outputDir = outputDir)
## Remove duplicate reads ...
## Peak calling ...
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## computing coverage for plus strand ...
## computing coverage for minus strand ...
## call peaks ...
## finding local max for chromosome: chr13
## combine plus and minus peaks ...
## keep peaks not in merged.gr but present in both peaks1 and peaks2
## Find unmerged peaks with reads representation in both libraries
## offtarget analysis ...
## search for gRNAs for input file1...
## [1] "Scoring ..."
## >>> Finding all hits in sequence chr13+:27629413:27629420:chr13-:27629400:27629404 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:39262927:39262939:chr13-:39262918:39262920 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:41969948:41969968:chr13-:41969948:41969967 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:88900985:88901002:chr13-:88900981:88901000 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:19451019:19451039 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:19774713:19774728 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:20683165:20683185 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:20865113:20865133 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:20979028:20979048 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21395595:21395615 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21433912:21433925 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21531840:21531856 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21537218:21537233 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21597770:21597790 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:21955661:21955681 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:22332147:22332167 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:22603877:22603897 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:22911530:22911550 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:23002153:23002173 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:23280771:23280783 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:23799953:23799973 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24060919:24060939 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24065254:24065274 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24493823:24493843 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24656963:24656976 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24813832:24813841 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24977283:24977303 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:24994998:24995012 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:25270857:25270860 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:25401847:25401850 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:25658368:25658388 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:25709772:25709792 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:26444955:26444975 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:26664550:26664570 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:26697477:26697485 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:26711781:26711797 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:27307572:27307592 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:27321560:27321580 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:27622701:27622721 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:27819707:27819721 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:27933064:27933084 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28034322:28034336 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28089775:28089795 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28176176:28176196 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28356573:28356593 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28461017:28461032 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28624328:28624348 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28629852:28629872 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28698872:28698891 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:28828738:28828758 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29057568:29057588 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29127567:29127582 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29276180:29276200 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29364136:29364156 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29485332:29485352 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29566885:29566905 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:29672862:29672882 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30203125:30203144 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30238844:30238864 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30276163:30276183 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30452447:30452467 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30554118:30554135 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30597241:30597261 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30599508:30599528 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30694345:30694365 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30810884:30810904 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30856209:30856229 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:30964712:30964730 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:31007789:31007802 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:31759761:31759781 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:31772903:31772923 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32215373:32215383 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32281690:32281710 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32427395:32427406 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32781661:32781681 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32972098:32972118 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:32979368:32979388 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:33184024:33184040 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:33245716:33245736 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:33291819:33291828 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:33388545:33388565 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:33974887:33974907 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34106340:34106360 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34238505:34238525 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34271289:34271306 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34287954:34287974 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34355586:34355606 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34474961:34474981 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:34924086:34924106 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:35163892:35163912 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:35302032:35302052 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:35461316:35461336 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36311098:36311118 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36410405:36410424 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36451743:36451763 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36467957:36467977 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36475627:36475639 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36648631:36648638 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36790438:36790458 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36846212:36846232 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:36972569:36972589 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:37177652:37177672 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:37188258:37188278 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:37391690:37391710 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38239974:38239990 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38436026:38436045 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38659272:38659284 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38701934:38701954 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38834551:38834568 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:38892524:38892542 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39312703:39312713 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39506927:39506947 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39618015:39618035 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39709866:39709878 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39728550:39728570 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39756855:39756875 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:39910214:39910234 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40048935:40048953 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40265530:40265547 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40266901:40266921 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40320353:40320373 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40521328:40521348 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40685701:40685721 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40712154:40712174 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:40784423:40784434 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41009823:41009843 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41051262:41051282 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41345945:41345958 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41382792:41382811 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41512230:41512250 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41531630:41531647 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41660498:41660518 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41707491:41707506 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41715924:41715944 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41727054:41727074 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:41953616:41953630 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42095491:42095511 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42129737:42129750 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42339589:42339609 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42529280:42529300 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42529347:42529367 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42710199:42710218 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42757033:42757050 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42819045:42819054 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42858076:42858096 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:42931780:42931788 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43111196:43111215 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43413734:43413752 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43597185:43597205 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43674933:43674953 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43873566:43873586 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:43902366:43902386 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44034936:44034952 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44226190:44226210 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44346880:44346897 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44578691:44578711 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44739966:44739986 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44882155:44882175 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:44956572:44956583 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45014719:45014736 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45026400:45026420 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45147331:45147351 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45284188:45284208 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45338413:45338430 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45550310:45550330 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45562031:45562049 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45632506:45632526 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45745140:45745160 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:45846548:45846562 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46038887:46038907 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46269643:46269661 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46352682:46352702 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46533927:46533947 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46631176:46631193 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46662028:46662048 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46737759:46737776 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:46894513:46894528 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47282734:47282754 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47486142:47486162 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47522008:47522028 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47571447:47571466 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47662169:47662189 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47704314:47704334 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47718020:47718040 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:47974473:47974493 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48178720:48178737 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48336308:48336328 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48422311:48422331 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48424524:48424544 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48539618:48539636 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48717076:48717096 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48767288:48767308 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48852788:48852808 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:48891644:48891664 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13+:48897178:48897198 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49135401:49135421 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49275286:49275306 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49524953:49524973 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49655748:49655768 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49883594:49883614 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:49981991:49982004 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:50005831:50005851 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:50054700:50054720 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:50349989:50350009 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:50626631:50626651 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:51437573:51437591 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:51625504:51625524 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:51720680:51720700 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52161681:52161701 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52319859:52319878 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52456036:52456056 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52578116:52578136 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52607347:52607367 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:52992711:52992721 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:53049203:53049222 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:53473146:53473166 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:53476908:53476928 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:53726174:53726192 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:54396547:54396567 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:54463425:54463445 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:54499866:54499886 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:54584999:54585019 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:55556978:55556998 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:55682224:55682242 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:55837741:55837761 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:55873756:55873776 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56158731:56158747 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56195073:56195093 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56480149:56480169 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56672556:56672576 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56778250:56778270 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:56794272:56794292 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57279246:57279266 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57389308:57389322 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57409063:57409083 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57466324:57466341 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57539471:57539491 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:57590857:57590877 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:58198379:58198399 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:58811299:58811315 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:59321224:59321234 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:59402412:59402431 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:59699240:59699259 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60072910:60072924 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60158054:60158074 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60593732:60593750 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60595821:60595841 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60661911:60661931 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60699717:60699737 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60705565:60705584 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60723880:60723897 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60819158:60819178 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:60961670:60961690 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61008334:61008354 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61253617:61253637 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61275870:61275881 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61425568:61425588 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61600202:61600220 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:61630757:61630777 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:62335675:62335689 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:62374401:62374421 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:62763516:62763528 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:62951227:62951247 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63045056:63045070 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63229246:63229266 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63304807:63304827 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63354794:63354813 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63678716:63678736 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:63943301:63943321 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64062903:64062923 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64277432:64277452 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64278537:64278555 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64324447:64324464 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64523152:64523168 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64697138:64697156 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:64985922:64985933 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:65147018:65147038 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:65479900:65479919 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:65642110:65642130 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:65674512:65674532 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66088875:66088887 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66102173:66102193 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66142915:66142929 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66275275:66275295 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66672052:66672072 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66674048:66674068 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66687218:66687225 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66713357:66713377 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:66748137:66748157 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:67161908:67161923 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:67211595:67211615 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:67666849:67666869 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:67674190:67674210 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68098774:68098793 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68577279:68577299 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68721766:68721786 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68729121:68729141 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68832161:68832181 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:68880904:68880924 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:69168732:69168752 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:69331586:69331606 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:69333526:69333543 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:69794023:69794043 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:69979979:69979999 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:70014596:70014616 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:70214063:70214083 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:70400872:70400892 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:70778291:70778303 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:71450827:71450847 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:71569761:71569781 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:71809031:71809046 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72061592:72061612 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72199365:72199382 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72295558:72295578 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72450690:72450710 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72543548:72543568 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72876451:72876471 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:72877281:72877301 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:73133992:73134012 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:73223297:73223317 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:73912995:73913015 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:74300367:74300387 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:74862449:74862469 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75163223:75163242 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75486669:75486682 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75795845:75795865 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75808127:75808147 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75866849:75866868 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:75873960:75873974 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:76169736:76169748 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:76197792:76197812 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:76257063:76257083 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:76570864:76570884 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:76987722:76987742 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:77614104:77614124 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:77650133:77650153 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:78038287:78038306 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:78067113:78067133 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79186565:79186585 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79233416:79233436 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79272660:79272676 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79396098:79396118 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79646740:79646754 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:79793144:79793162 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80012718:80012735 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80103237:80103254 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80104178:80104198 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80149340:80149360 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80202403:80202423 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80342997:80343017 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80587160:80587167 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:80935635:80935655 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81031075:81031093 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81049026:81049046 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81169450:81169470 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81611004:81611015 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81723829:81723849 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:81964890:81964907 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:82000211:82000231 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:83048073:83048093 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:83276111:83276131 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:83326314:83326334 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:83534130:83534146 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:84007142:84007162 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:84085196:84085216 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:84567136:84567156 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:84724231:84724251 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:85920992:85921010 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:85991122:85991142 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86050610:86050622 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86067473:86067492 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86100502:86100522 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86118069:86118089 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86229498:86229518 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86444785:86444805 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86502058:86502077 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86704005:86704025 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:86961625:86961641 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:87731872:87731892 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:87981413:87981433 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:87998217:87998237 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:88154507:88154527 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:88739604:88739623 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:88921483:88921503 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:88941751:88941771 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89108181:89108197 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89135772:89135792 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89257633:89257639 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89277847:89277855 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89542656:89542676 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89573464:89573484 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:89661789:89661809 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:90260614:90260633 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:90696263:90696283 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:90949682:90949701 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91014634:91014654 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91051268:91051285 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91066825:91066845 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91130287:91130307 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91424125:91424138 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91453310:91453330 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:91667710:91667724 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:92034448:92034468 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:92163552:92163572 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:92228060:92228080 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:92338175:92338194 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:92759539:92759559 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:93027097:93027113 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:93370506:93370526 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:93536174:93536194 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:93860000:93860020 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94404987:94405007 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94471544:94471564 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94491399:94491419 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94545485:94545505 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94580031:94580051 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94584014:94584032 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94623768:94623786 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94747980:94747997 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:94970346:94970366 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95038883:95038903 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95042064:95042084 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95083197:95083217 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95334184:95334204 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95629464:95629483 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95758784:95758802 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:95834925:95834945 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96008538:96008558 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96087191:96087207 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96142402:96142422 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96187227:96187247 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96233915:96233932 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96236519:96236539 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96314843:96314863 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96315475:96315491 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96397725:96397745 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96458278:96458294 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96548026:96548046 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96810905:96810910 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96900199:96900219 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:96924890:96924910 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:97331552:97331572 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:97603947:97603967 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98082739:98082759 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98226906:98226924 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98249472:98249489 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98294162:98294182 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98308991:98309011 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98463356:98463376 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98481446:98481466 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98879694:98879713 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:98955182:98955202 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99143071:99143091 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99201113:99201127 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99202269:99202289 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99211830:99211850 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99240746:99240763 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99260864:99260884 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99333327:99333347 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99746266:99746286 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99817466:99817486 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99851257:99851277 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:99974595:99974615 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:100041263:100041283 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:100412698:100412718 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:100659269:100659287 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:100678050:100678068 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101067336:101067356 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101263831:101263849 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101276598:101276606 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101300982:101301002 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101497256:101497267 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:101498260:101498280 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102176734:102176753 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102270775:102270795 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102348152:102348172 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102361720:102361732 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102459478:102459498 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102488452:102488472 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102859960:102859980 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102876203:102876217 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:102882645:102882665 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103127239:103127259 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103143587:103143607 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103164753:103164773 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103198255:103198275 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103207541:103207561 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103718300:103718320 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103723858:103723878 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103845512:103845532 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:103903988:103904007 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:104117636:104117656 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:104512521:104512541 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:105031211:105031231 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:105479084:105479103 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106024396:106024414 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106088825:106088842 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106478339:106478350 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106555892:106555912 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106597666:106597686 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106759350:106759370 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:106984447:106984467 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107062489:107062506 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107270431:107270451 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107490648:107490659 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107687922:107687942 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107714631:107714646 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:107911428:107911448 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108159935:108159947 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108220390:108220410 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108251762:108251773 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108371912:108371932 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108493971:108493990 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108743205:108743225 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:108784111:108784130 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109177416:109177436 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109316130:109316144 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109405716:109405730 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109431618:109431638 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109445628:109445644 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109609725:109609742 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:109860531:109860550 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:110275966:110275983 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:110322132:110322144 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:110761114:110761134 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:111245411:111245431 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:111248109:111248129 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:111453143:111453163 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:112061959:112061979 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:112272847:112272867 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:112607350:112607370 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:112640360:112640380 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:112838641:112838661 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113355938:113355958 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113358025:113358045 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113856476:113856495 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113934608:113934628 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113934681:113934698 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113961433:113961453 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:113978046:113978066 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:114119804:114119822 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:114526058:114526078 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13+:114821847:114821866 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20307056:20307076 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20404987:20405005 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20456071:20456091 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20500513:20500528 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20513171:20513185 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20534508:20534528 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20585722:20585742 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20631006:20631023 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20697822:20697842 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:20958598:20958617 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21200207:21200207 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21241752:21241772 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21412469:21412489 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21484220:21484240 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21499162:21499182 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21639776:21639795 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21741290:21741310 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21818300:21818309 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:21967341:21967361 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:22205500:22205520 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:22237521:22237538 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:22570627:22570641 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:22813780:22813800 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:22974173:22974193 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23196106:23196126 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23234477:23234497 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23325288:23325297 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23368114:23368134 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23579215:23579235 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23713999:23714011 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23766660:23766680 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23777352:23777358 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23782101:23782121 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23884226:23884240 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:23902151:23902171 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:24047926:24047946 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:24247023:24247040 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:24442573:24442593 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:24473177:24473194 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:24790063:24790083 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:25301426:25301446 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:25344219:25344239 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:25394267:25394274 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:25504061:25504078 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:25874338:25874356 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:26699598:26699618 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:27130466:27130486 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:27203945:27203965 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:27911305:27911323 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28167903:28167918 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28197618:28197638 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28305886:28305903 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28574170:28574190 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28592998:28593018 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28735939:28735959 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:28985164:28985184 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29038737:29038757 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29087136:29087137 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29092463:29092483 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29232634:29232654 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29514039:29514059 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29920277:29920297 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:29925922:29925941 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:30784694:30784714 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:30981770:30981789 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:31021250:31021270 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:31308174:31308194 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:31696568:31696588 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:31904692:31904701 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:32075248:32075268 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:32622950:32622970 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:32988347:32988367 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33070345:33070365 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33100973:33100984 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33381640:33381660 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33391847:33391865 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33419273:33419293 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33548613:33548630 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33691070:33691090 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33740340:33740360 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33839882:33839901 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33855897:33855917 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:33989580:33989600 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34107713:34107733 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34203716:34203736 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34270845:34270865 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34535815:34535835 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34555755:34555773 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34566313:34566333 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34582015:34582029 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34713621:34713634 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:34763328:34763342 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:35256678:35256698 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:35763063:35763067 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:35981106:35981125 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36306251:36306265 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36343105:36343125 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36386028:36386048 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36388465:36388485 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36479172:36479188 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36569968:36569988 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36708337:36708357 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36743235:36743255 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36810870:36810890 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36871243:36871263 ...
## >>> DONE searching
## >>> Finding all hits in sequence chr13-:36902521:36902538 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:36918374:36918392 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37146835:37146855 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37159245:37159265 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37190167:37190187 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37375559:37375577 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37377991:37378011 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37384633:37384653 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37562262:37562282 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37706926:37706946 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:37771595:37771612 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38042034:38042053 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38137847:38137867 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38496991:38497007 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38578892:38578912 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38630169:38630188 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:38992375:38992395 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:39221866:39221886 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:39402857:39402871 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:39437880:39437900 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:39565714:39565730 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:39742041:39742051 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:40018201:40018221 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:40590765:40590785 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:40664139:40664156 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:40897086:40897106 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41091868:41091888 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41092346:41092366 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41110384:41110391 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41138930:41138950 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41226358:41226378 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41228807:41228826 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41582598:41582618 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41736103:41736123 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41784938:41784953 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41854873:41854893 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:41961063:41961083 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:42115389:42115409 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:42269965:42269985 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:42493789:42493809 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:42908468:42908488 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43123301:43123321 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43123881:43123901 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43204676:43204696 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43318734:43318754 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43563709:43563729 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43583681:43583700 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43598494:43598501 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43661924:43661944 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:43758082:43758099 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:44559770:44559790 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:44624292:44624310 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45124361:45124381 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45142054:45142074 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45195616:45195636 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45351135:45351152 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45521306:45521322 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45523351:45523363 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45747760:45747777 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:45828713:45828733 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46048297:46048313 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46080578:46080598 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46107394:46107411 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46175249:46175269 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46386046:46386066 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46389232:46389252 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46407694:46407714 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46678265:46678282 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46797627:46797647 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46863365:46863385 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:46919685:46919705 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47039491:47039511 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47135885:47135905 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47163742:47163762 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47412479:47412499 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47538520:47538540 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47601844:47601864 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47709900:47709920 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:47995465:47995482 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as increasing max.mismatch!
## >>> Finding all hits in sequence chr13-:48746140:48746154 ...
## >>> DONE searching
## Warning in searchHits(gRNAs = gRNAs1, PAM = PAM, PAM.pattern = PAM.pattern, : No matching found, please check your input sequence, and make
##             sure you are using the right genome. You can also alter your 
##             search criteria such as in