Contents

1 Overview

miRBaseConverter is an R/Bioconductor package for converting and retrieving the definition of miRNAs ( Names, Accessions, Sequences, Families and others) in different miRBase versions ( From miRBase version 6 to version 21 [ The latest version ] ). A tiny built-in database is embedded in the miRBaseConverter R package for retrieving miRNA information efficiently.

microRNAs( miRNAs) are one of the essential molecules that play the important role in the post-transcriptional gene regulation. The studies about novel miRNA and their function discoveries have an explosive growth in the last decade. The miRBase database is the authority archive of miRNA annotations and sequences for all species. With the development of researches about miRNAs, the annotation of miRNA has been changed significantly and develops many different historical versions. Each of the previous versions has been adopted in many research literatures and databases. Due to the inconsistent of name annotation of miRNAs, there is a barrier for the later scholars to reuse the previous research results in a convenient way, especially for miRNA databases with thousands of entries. There are some webservers or R-based tools can handle the batch conversion of miRNA names. However, an easy-to-use and well-documented tool for miRNA conversion and information retrieval is still lack. We present the miRBaseConverter R package, a comprehensive tool for miRNA research, to provide a suite of tools for checking miRNA Name, Accession, Sequence, version and family and history information. The miRBaseConverter package can be competent for all species including Precursor and Mature miRNAs defined in miRBase.

In the following sections, we present the detail usage of the functions included in the miRBaseConverter package.

2 miRNA Version check

For a list of miRNA names without version information, users may need to check what is the most possible miRBase version. miRBaseConverter package provides an easy-to-use function checkMiRNAVersion() to address this issue with an straightforward result.

library(miRBaseConverter)
data(miRNATest)
miRNANames = miRNATest$miRNA_Name
version=checkMiRNAVersion(miRNANames, verbose = TRUE)
##    Version Proportion           Recommend
## 1       v6     12.33%                    
## 2     v7_1     18.67%                    
## 3       v8     18.83%                    
## 4     v8_1     20.33%                    
## 5     v8_2      20.5%                    
## 6       v9        22%                    
## 7     v9_1        26%                    
## 8     v9_2        26%                    
## 9      v10        29%                    
## 10   v10_1      29.5%                    
## 11     v11      32.5%                    
## 12     v12        34%                    
## 13     v13     35.33%                    
## 14     v14      45.5%                    
## 15     v15     51.67%                    
## 16     v16     51.67%                    
## 17     v17     51.83%                    
## 18     v18     98.67%  ***BEST Matched***
## 19     v19     90.83%                    
## 20     v20     82.83%                    
## 21     v21      78.5%

The output text in console shows the matched proportions in all the miRBase version and gives the recommended version which is the best matched with the highest proportion values. This function is of great helpful miRNA version checking of a chunk of miRNAs.

3 The conversion between miRBase Accession and miRNA Name

3.1 miRBase Accession to miRNA Name

An Accession is the identifier that define miRNA uniquely in miRBase. Users can apply Accessions to retrieve the entire information of the miRNAs in miRBase. One of the most commonly used functions is to retrieve the corresponding miRNA name from Accession. The manual retrieval one by one in miRBase could be a tough work for a chunk of Accessions of interest. The function miRNA_AccessionToName() in miRBaseConverter package can conduct a high throughput transformation within quite short time.

library(miRBaseConverter)
data(miRNATest)
Accessions = miRNATest$Accession

#### 1. Convert to the Accessions to miRNA names in miRBase version 13
result1 = miRNA_AccessionToName(Accessions,targetVersion = "v13")
result1[c(341:345),]
##        Accession   TargetName
## 341 MIMAT0002843 hsa-miR-520b
## 342 MIMAT0001650  mtr-miR399c
## 343 MIMAT0000013   cel-miR-42
## 344 MIMAT0002885  osa-miR529a
## 345 MIMAT0011111         <NA>

####2. Convert to the Accessions to miRNA names in miRBase version 21.
result2 = miRNA_AccessionToName(Accessions,targetVersion = "v21")
result2[c(341:345),]
##        Accession    TargetName
## 341 MIMAT0002843  hsa-miR-520b
## 342 MIMAT0001650   mtr-miR399c
## 343 MIMAT0000013 cel-miR-42-3p
## 344 MIMAT0002885   osa-miR529a
## 345 MIMAT0011111   mtr-miR169b

3.2 miRNA Name to miRBase Accession

The conversion of miRNA Name to Accession is the reversion process. Due to the frequent changes of miRNA name in different versions, researches are likely to adopt the miRBase Accessions as the identifiers in most literatures and databases.

library(miRBaseConverter)
data(miRNATest)
miRNANames = miRNATest$miRNA_Name
result1 = miRNA_NameToAccession(miRNANames,version = "v18")
result1[c(341:345),]
##     miRNAName_v18    Accession
## 341  hsa-miR-520b MIMAT0002843
## 342   mtr-miR399c MIMAT0001650
## 343 cel-miR-42-3p MIMAT0000013
## 344   osa-miR529a MIMAT0002885
## 345   mtr-miR169j MIMAT0011111

4 The conversion of miRNA Names between two different miRBase versions

In miRBaseConverter package, there are two ways to conduct the conversion of miRNA Names between two different miRBase versions.

4.1 Solution 1: Global searching and matching

miRBaseConverter package provides the miRNAVersionConvert() function to detect all the match miRNA Names with the same Accession in all miRBase historical versions. The conversion result may not match to the unique Name for some miRNAs but it is useful for all possible information retrieval for the miRNAs of interest.

library(miRBaseConverter)
data(miRNATest)
miRNANames = miRNATest$miRNA_Name
result1 = miRNAVersionConvert(miRNANames,targetVersion = "v13",exact = TRUE)
## ********************************************
## The multiple matched miRNAs are list below:
##     original           Version v13              Accession
## 1 hsa-let-7c hsa-let-7c&hsa-let-7c MI0000064&MIMAT0000064
## 2  cel-lsy-6   cel-lsy-6&cel-lsy-6 MI0000801&MIMAT0000749
result1[c(341:345),]
##      OriginalName   TargetName    Accession
## 341  hsa-miR-520b hsa-miR-520b MIMAT0002843
## 342   mtr-miR399c  mtr-miR399c MIMAT0001650
## 343 cel-miR-42-3p   cel-miR-42 MIMAT0000013
## 344   osa-miR529a  osa-miR529a MIMAT0002885
## 345   mtr-miR169j         <NA>         <NA>

result2 = miRNAVersionConvert(miRNANames,targetVersion = "v20",exact = TRUE)
## ********************************************
## 
## The multiple matched miRNAs are list below:
##    original         Version v20              Accession
## 1 cel-lsy-6 cel-lsy-6&cel-lsy-6 MI0000801&MIMAT0000749

result2[c(341:345),]
##      OriginalName    TargetName    Accession
## 341  hsa-miR-520b  hsa-miR-520b MIMAT0002843
## 342   mtr-miR399c   mtr-miR399c MIMAT0001650
## 343 cel-miR-42-3p cel-miR-42-3p MIMAT0000013
## 344   osa-miR529a   osa-miR529a MIMAT0002885
## 345   mtr-miR169j   mtr-miR169j MIMAT0013321

4.2 Solution 2: miRNA Names conversion with three steps

The miRBase Accession can be a bridge to exactly match miRNA Name between two different miRBase versions. For a group of miRNA Names, users could apply the function checkMiRNAVersion() to check the possible miRNA version firstly. Then the miRNA Names accompanying with the version information are mapped to the Accessions using the function miRNA_NameToAccession(). In the last step, the Accessions can be easily mapped to the miRNA Names in the target version. This approach can output more exact result than the global searching and matching.
[ checkMiRNAVersion()-> miRNA_NameToAccession() -> miRNA_AccessionToName() ]

library(miRBaseConverter)
data(miRNATest)
miRNANames = miRNATest$miRNA_Name

#### Step 1. Check the possible version for miRNAs
data(miRNATest)
miRNANames = miRNATest$miRNA_Name
version=checkMiRNAVersion(miRNANames, verbose = FALSE)

#### Step 2. miRNA Names to miRBase Accessions with the specific version information
result1 = miRNA_NameToAccession(miRNANames,version = version)

#### Step 3. miRBase Accessions to miRNA Names of the target version
result2 = miRNA_AccessionToName(result1[,2],targetVersion = "v21")
result2[c(341:345),]
##        Accession    TargetName
## 341 MIMAT0002843  hsa-miR-520b
## 342 MIMAT0001650   mtr-miR399c
## 343 MIMAT0000013 cel-miR-42-3p
## 344 MIMAT0002885   osa-miR529a
## 345 MIMAT0011111   mtr-miR169b

5 The conversion between Precursor and Mature miRNA

A Precursor miRNA is about 70mer RNA with a stem-loop to form as a hairpin structure. The 5’ UTR and/or 3’ UTR of the stem-loop can be cleaved by dicer to generate one or two mature miRNAs ( about 22 nucleotides ). In miRBaseConverter package, we provide the functions for conversion between precursors and mature miRNAs.

5.1 Mature miRNA to Precursor

library(miRBaseConverter)
data(miRNATest)
miRNANames=miRNATest$miRNA_Name
result1=miRNA_MatureToPrecursor(miRNANames)
## The input miRNA version information: miRBase v18
head(result1)
##      OriginalName      Precursor
## 1   cel-miR-46-3p     cel-mir-46
## 2   cel-miR-81-3p     cel-mir-81
## 3    cel-miR-1817   cel-mir-1817
## 4 hsa-miR-196a-5p hsa-mir-196a-1
## 5  mmu-miR-149-5p    mmu-mir-149
## 6     mtr-miR166d    mtr-MIR166d

5.2 Precursor to Mature miRNA

library(miRBaseConverter)
miRNANames=c("pma-mir-100a","sko-mir-92a","hsa-mir-6131","mtr-MIR2655i",
"mmu-mir-153","mtr-MIR2592am","mml-mir-1239","xtr-mir-128-2","oan-mir-100",
"mmu-mir-378b","hsa-miR-508-5p","mmu-miR-434-3p")
result2=miRNA_PrecursorToMature(miRNANames)
## The input miRNA version information: miRBase v21
head(result2)
##    OriginalName         Mature1         Mature2
## 1  pma-mir-100a pma-miR-100a-5p pma-miR-100a-3p
## 2   sko-mir-92a     sko-miR-92a            <NA>
## 3  hsa-mir-6131    hsa-miR-6131            <NA>
## 4  mtr-MIR2655i    mtr-miR2655i            <NA>
## 5   mmu-mir-153  mmu-miR-153-5p  mmu-miR-153-3p
## 6 mtr-MIR2592am   mtr-miR2592am            <NA>

6 Retrieve the Family category of miRNAs

miRNAs are manually classified by the single-linkage method to cluster the precursor sequences based on BLAST hits and adjusted manually the clustered families by multiple sequence alignment in miRBase. The family classification is based on a common ancestor for each family representing sequences. Normally, the miRNAs from the same family may possess similar physiological functions in cell metabolism. In miRBaseConverter package, the function checkMiRNAFamliy() is specifically designed for the retrieval information of miRNA families. It can be applied to retrieve the miRNA families and family accessions for a list of miRNAs.

library(miRBaseConverter)
## The input is miRNA Accessions
Accessions=miRNATest$Accession
Family_Info1=checkMiRNAFamliy(Accessions)
head(Family_Info1)
##      Accession   miRNAName_v21 FamilyAccession  Family
## 1 MIMAT0000017   cel-miR-46-3p     MIPF0000087  mir-46
## 2 MIMAT0000054   cel-miR-81-3p     MIPF0000154  mir-81
## 3 MIMAT0006584    cel-miR-1817            <NA>    <NA>
## 4 MIMAT0000226 hsa-miR-196a-5p     MIPF0000031 mir-196
## 5 MIMAT0000159  mmu-miR-149-5p     MIPF0000274 mir-149
## 6 MIMAT0011068     mtr-miR166d     MIPF0000004  MIR166

##The input is miRNA names
miRNANames=miRNATest$miRNA_Name
version=checkMiRNAVersion(miRNANames,verbose = FALSE)
result=miRNA_NameToAccession(miRNANames,version=version)
Accessions=result$Accession
Family_Info2=checkMiRNAFamliy(Accessions)
head(Family_Info2)
##      Accession   miRNAName_v21 FamilyAccession  Family
## 1 MIMAT0000017   cel-miR-46-3p     MIPF0000087  mir-46
## 2 MIMAT0000054   cel-miR-81-3p     MIPF0000154  mir-81
## 3 MIMAT0006584    cel-miR-1817            <NA>    <NA>
## 4 MIMAT0000226 hsa-miR-196a-5p     MIPF0000031 mir-196
## 5 MIMAT0000159  mmu-miR-149-5p     MIPF0000274 mir-149
## 6 MIMAT0011068     mtr-miR166d     MIPF0000004  MIR166

7 Retrieve some of detailed miRNA information in miRBase

7.1 Retrieve the Sequence of miRNAs

The miRNA sequence is great important for base alignment in the research of gene regulation. In miRBaseConverter package, we provide an efficient tool to batch retrieve the sequence of miRNAs based on the Accessions. It will be great help of automated analyses of sequence alignment between miRNAs and their target molecules.

library(miRBaseConverter)
data(miRNATest)
Accessions = miRNATest$Accession
result1 = getMiRNASequence(Accessions,targetVersion = "v13")
head(result1)
##      Accession       miRNASequence_v13
## 1 MIMAT0000017  UGUCAUGGAGUCGCUCUCUUCA
## 2 MIMAT0000054  UGAGAUCAUCGUGAAAGCUAGU
## 3 MIMAT0006584 UAGCCAAUGUCUUCUCUAUCAUG
## 4 MIMAT0000226  UAGGUAGUUUCAUGUUGUUGGG
## 5 MIMAT0000159 UCUGGCUCCGUGUCUUCACUCCC
## 6 MIMAT0011068                    <NA>

result2 = getMiRNASequence(Accessions,targetVersion = "v21")
head(result2)
##      Accession       miRNASequence_v21
## 1 MIMAT0000017  UGUCAUGGAGUCGCUCUCUUCA
## 2 MIMAT0000054  UGAGAUCAUCGUGAAAGCUAGU
## 3 MIMAT0006584 UAGCCAAUGUCUUCUCUAUCAUG
## 4 MIMAT0000226  UAGGUAGUUUCAUGUUGUUGGG
## 5 MIMAT0000159 UCUGGCUCCGUGUCUUCACUCCC
## 6 MIMAT0011068   UCGGGCCAGGCUUCAUCCCCC

7.2 Retrieve all the miRBase version information

Currently, the latest miRBase version is 21 which was released in June 2014. In miRBaseConverter package, we implement a query function to check all the miRBase version information from miRBase version 1 to version 21. The return includes the information of the defined version names, release dates, the number of defined miRNAs (Entries including Precursors and Mature miRNAs) and the available status in miRBaseConverter package.

library(miRBaseConverter)
getAllVersionInfo()
##    Version    Date Entries      Status
## 1       v1 12/2002     218 Unavailable
## 2     v1_1 01/2003     262 Unavailable
## 3     v1_2 04/2003     295 Unavailable
## 4     v1_3 05/2003     332 Unavailable
## 5     v1_4 07/2003     345 Unavailable
## 6       v2 07/2003     506 Unavailable
## 7     v2_1 09/2003     558 Unavailable
## 8     v2_2 11/2003     593 Unavailable
## 9       v3 01/2004     719 Unavailable
## 10    v3_1 04/2004     899 Unavailable
## 11      v4 07/2004    1185 Unavailable
## 12      v5 09/2004    1345 Unavailable
## 13    v5_1 12/2004    1420 Unavailable
## 14      v6 04/2005    1650   Available
## 15      v7 06/2005    2909 Unavailable
## 16    v7_1 10/2005    3424   Available
## 17      v8 02/2006    3518   Available
## 18    v8_1 05/2006    3963   Available
## 19    v8_2 07/2006    4039   Available
## 20      v9 10/2006    4361   Available
## 21    v9_1 02/2007    4449   Available
## 22    v9_2 05/2007    4584   Available
## 23     v10 08/2007    5071   Available
## 24   v10_1 12/2007    5395   Available
## 25     v11 04/2008    6396   Available
## 26     v12 09/2008    8619   Available
## 27     v13 03/2009    9539   Available
## 28     v14 09/2009   10883   Available
## 29     v15 04/2010   14197   Available
## 30     v16 08/2010   15172   Available
## 31     v17 04/2011   16772   Available
## 32     v18 11/2011   18226   Available
## 33     v19 08/2012   21264   Available
## 34     v20 06/2013   24521   Available
## 35     v21 06/2014   28645   Available

7.3 Retrieve all the available species in miRBase

miRBase has defined the miRNAs for hundreds of species. In miRBaseConverter package, users can apply the function getAllSpecies() to check the abbreviation and the full name of the available species.

library(miRBaseConverter)
allSpecies=getAllSpecies()
head(allSpecies)
##   Species              FullName
## 1     aae         Aedes aegypti
## 2     aau Acacia auriculiformis
## 3     aca   Anolis carolinensis
## 4     aga     Anopheles gambiae
## 5     age      Ateles geoffroyi
## 6     ahy      Arachis hypogaea

7.4 Retrieve all the available miRNAs in the specified miRBase version

In miRBaseConverter package, the function getAllMiRNAs() can be applied to get all miRNAs which are defined in each available miRBase version. Meanwhile, users can use the control parameters to custom the species and miRNA type in the output.

library(miRBaseConverter)
miRNAs=getAllMiRNAs(version="v21", type="all", species="hsa")
head(miRNAs)
##      Accession            Name                                                                            Sequence
## 1    MI0000061    hsa-let-7a-2            AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
## 2 MIMAT0010195 hsa-let-7a-2-3p                                                              CUGUACAGCCUCCUAGCUUUCC
## 3    MI0000062    hsa-let-7a-3          GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU
## 4 MIMAT0004481   hsa-let-7a-3p                                                               CUAUACAAUCUACUGUCUUUC
## 5 MIMAT0000062   hsa-let-7a-5p                                                              UGAGGUAGUAGGUUGUAUAGUU
## 6    MI0000063      hsa-let-7b CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG

7.5 Retrieve all the history information of a single miRNA

In some applications, users may want to have a comprehensive investigation of a miRNA about the Name, Accession, Sequence, Precursor and mature miRNA information. The miRBaseConverter package embeds a useful function getMiRNAHistory() to retrieve all the detailed miRNA information in all miRBase historic version. Users can get a comprehensive overview of the miRNA.

#### 1. The input is a miRNA Name
name = "hsa-miR-26b-5p"
result1 = miRNA_NameToAccession(name)
Accession = result1$Accession
result2 = getMiRNAHistory(Accession)
result2
##         Precursor                                                             PrecursorSequence        Mature1        Mature1Sequence        Mature2        Mature2Sequence    Status
## v6    hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v7_1  hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA>      <NA>
## v8    hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v8_1  hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v8_2  hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v9    hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v9_1  hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v9_2  hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b UUCAAGUAAUUCAGGAUAGGUU           <NA>                   <NA> UNCHANGED
## v10   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v10_1 hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v11   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v12   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v13   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v14   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v15   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v16   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v17   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG    hsa-miR-26b  UUCAAGUAAUUCAGGAUAGGU   hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v18   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG hsa-miR-26b-5p  UUCAAGUAAUUCAGGAUAGGU hsa-miR-26b-3p CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v19   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG hsa-miR-26b-5p  UUCAAGUAAUUCAGGAUAGGU hsa-miR-26b-3p CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v20   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG hsa-miR-26b-5p  UUCAAGUAAUUCAGGAUAGGU hsa-miR-26b-3p CCUGUUCUCCAUUACUUGGCUC UNCHANGED
## v21   hsa-mir-26b CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG hsa-miR-26b-5p  UUCAAGUAAUUCAGGAUAGGU hsa-miR-26b-3p CCUGUUCUCCAUUACUUGGCUC UNCHANGED
#### 2. The input is miRNA Accession Id
Accession = "MIMAT0000765"
result3 = getMiRNAHistory(Accession)
result3
##         Precursor                                                                              PrecursorSequence        Mature1         Mature1Sequence        Mature2        Mature2Sequence    Status
## v6    hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v7_1  hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA>      <NA>
## v8    hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v8_1  hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v8_2  hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v9    hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v9_1  hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v9_2  hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU           <NA>                   <NA> UNCHANGED
## v10   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v10_1 hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v11   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v12   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v13   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v14   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v15   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v16   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v17   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA    hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU   hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v18   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v19   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v20   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC UNCHANGED
## v21   hsa-mir-335 UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU hsa-miR-335-3p UUUUUCAUUAUUGCUCCUGACC UNCHANGED

7.6 Retrieve the data table for the specified miRBase version

There is a data table for presenting the detailed information of the defined miRNAs in each miRBase version. In miRBaseConverter package, we provide a function getMiRNATable() to return the miRNA data table for each miRBase version. Meanwhile, users can use the control parameter to custom the species in output.

library(miRBaseConverter)
miRNA_Tab=getMiRNATable(version="v21",species="hsa")
head(miRNA_Tab)
##       Precursor_Acc    Precursor    Status                                                                           Precursor_Seq  Mature1_Acc       Mature1            Mature1_Seq  Mature2_Acc         Mature2            Mature2_Seq
## 12741     MI0000060 hsa-let-7a-1 UNCHANGED        UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA MIMAT0000062 hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU MIMAT0004481   hsa-let-7a-3p  CUAUACAAUCUACUGUCUUUC
## 12742     MI0000061 hsa-let-7a-2 UNCHANGED                AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU MIMAT0000062 hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU MIMAT0010195 hsa-let-7a-2-3p CUGUACAGCCUCCUAGCUUUCC
## 12743     MI0000062 hsa-let-7a-3 UNCHANGED              GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU MIMAT0000062 hsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU MIMAT0004481   hsa-let-7a-3p  CUAUACAAUCUACUGUCUUUC
## 12744     MI0000063   hsa-let-7b UNCHANGED     CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG MIMAT0000063 hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU MIMAT0004482   hsa-let-7b-3p CUAUACAACCUACUGCCUUCCC
## 12745     MI0000064   hsa-let-7c UNCHANGED    GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC MIMAT0000064 hsa-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU MIMAT0026472   hsa-let-7c-3p CUGUACAACCUUCUAGCUUUCC
## 12746     MI0000065   hsa-let-7d UNCHANGED CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG MIMAT0000065 hsa-let-7d-5p AGAGGUAGUAGGUUGCAUAGUU MIMAT0004484   hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU

8 The online retrieving of miRNA information

8.1 Open the miRNA webpages in miRBase

In miRBaseConverter package, the function goTo_miRBase() redirects users to the miRBase webpages of some specified miRNAs.

library(miRBaseConverter)
Accessions=miRNATest$Accession[1:10]
goTo_miRBase(Accessions)

8.2 Open the miRNA family webpages in miRBase

In miRBaseConverter package, the function goTo_miRNAFamily() redirects users to the miRBase miRNA family webpages of some specified miRNA families.

library(miRBaseConverter)
Accessions=miRNATest$Accession
Family_Info=checkMiRNAFamliy(Accessions)
FamilyAccessions=Family_Info$FamilyAccession[1:15]
goTo_miRNAFamily(FamilyAccessions)

9 Conclusion

The R/Bioconductor package miRBaseConverter provides a suite of tools for checking miRNA Name, Accession, Sequence, Species, Version, Hisotry and Family information in different miRBase versions. We wish that the miRBaseConverter package could be a useful tool for miRNA research community and help to speed up the studies of miRNAs.

10 References

[1] Kozomara, Ana, and Sam Griffiths-Jones. “miRBase: annotating high confidence microRNAs using deep sequencing data.” Nucleic acids research 42.D1 (2014): D68-D73.

[2] Kozomara, Ana, and Sam Griffiths-Jones. “miRBase: integrating microRNA annotation and deep-sequencing data.” Nucleic acids research (2010): gkq1027.

[3] Griffiths-Jones, Sam, et al. “miRBase: tools for microRNA genomics.” Nucleic acids research 36.suppl 1 (2008): D154-D158.

[4] Griffiths-Jones, Sam, et al. “miRBase: microRNA sequences, targets and gene nomenclature.” Nucleic acids research 34.suppl 1 (2006): D140-D144.

[5] Ding, Jiandong, Shuigeng Zhou, and Jihong Guan. “miRFam: an effective automatic miRNA classification method based on n-grams and a multiclass SVM.” BMC bioinformatics 12.1 (2011): 216.

[6] Zou, Quan, et al. “miRClassify: an advanced web server for miRNA family classification and annotation.” Computers in biology and medicine 45 (2014): 157-160.